Journal: Frontiers in Aging Neuroscience

Article Title: Identification of CTHRC1 as a novel candidate for neurodevelopmental disorders

doi: 10.3389/fnagi.2026.1737003

Figure Lengend Snippet: Experimental workflow identifying CTHRC1 as a candidate gene for neurodegeneration and cognition.

Article Snippet: CTHRC1 CRISPR RNA (crRNA) (AUGGCAUUCCGGGU ACACCUGUUUUAGAGCUAUGCU) was synthesized by Azenta. crRNA annealed with tracrRNA (IDT), then incubated with Alt-R ® S.p.

Techniques:

Journal: Frontiers in Aging Neuroscience

Article Title: Identification of CTHRC1 as a novel candidate for neurodevelopmental disorders

doi: 10.3389/fnagi.2026.1737003

Figure Lengend Snippet: Association of Cthrc1 with cognition-related properties. (A) Top 50 differentially expressed proteins between human AD and control samples. (B) Expression of CTHRC1 protein between 6-month-old 5xFAD and WT mice. (C) Expression of Cthrc1 mRNA in mouse brain cell types based on single-cell RNA sequencing. The scRNA-seq data was collected from the Mouse Cell Atlas (MCA) database ( https://bis.zju.edu.cn/MCA/ ). (D) mRNA expression of Cthrc1 in the hippocampus of 69 BXD strains and two parental strains (B6 and D2). The expression data was obtained from our GeneNetwork database ( https://genenetwork.org/ ). (E,F) PheWAS and ePheWAS analysis of Cthrc1 in BXD mice. Each dot indicates a nervous system phenotype ( x -axis). The y -axis indicates the minus log10( p ) value. The red dotted line indicates the -log10( p ) threshold of 2. (G) Correlation between Cthrc1 mRNA levels and learning and memory phenotypes in BXD mice. Both expression data and phenotypes can be accessed from the GeneNetwork database ( https://genenetwork.org/ ) using the phenotype identifier. (H) Genomic variants in the human CTHRC1 locus are associated with different phenotypic traits, including those related to AD. The data is based on Genome-Wide Association Analysis (GWAS, https://www.ebi.ac.uk/gwas/ ).

Article Snippet: CTHRC1 CRISPR RNA (crRNA) (AUGGCAUUCCGGGU ACACCUGUUUUAGAGCUAUGCU) was synthesized by Azenta. crRNA annealed with tracrRNA (IDT), then incubated with Alt-R ® S.p.

Techniques: Control, Expressing, Single Cell, RNA Sequencing, GWAS

Journal: Frontiers in Aging Neuroscience

Article Title: Identification of CTHRC1 as a novel candidate for neurodevelopmental disorders

doi: 10.3389/fnagi.2026.1737003

Figure Lengend Snippet: Expression quantitative trait locus (eQTL) mapping for Cthrc1 expression in the hippocampus of BXD mice. Manhattan plots showing the eQTL (A) across the mouse genome and (B) on chromosome 15 for Cthrc1 , identified by the GEMMA mapping method. The x -axis indicates the position on the mouse genome in megabases (Mb), whereas the y -axis indicates the −log 10 ( p ) score, a value measuring the linkage between gene expression and genomic region. The blue triangle on the x -axis indicates the genomic position of the gene. The red horizontal line indicates the significant −log 10 ( p ) score threshold of 4. (C) Cthrc1 is significantly different ( p = 3.48E-05) between the B and D alleles at 38.99 Mb on Chr 15 (rs3660608).

Article Snippet: CTHRC1 CRISPR RNA (crRNA) (AUGGCAUUCCGGGU ACACCUGUUUUAGAGCUAUGCU) was synthesized by Azenta. crRNA annealed with tracrRNA (IDT), then incubated with Alt-R ® S.p.

Techniques: Expressing, Gas Phase Electrophoretic Molecular Mobility Analysis, Gene Expression

Journal: Frontiers in Aging Neuroscience

Article Title: Identification of CTHRC1 as a novel candidate for neurodevelopmental disorders

doi: 10.3389/fnagi.2026.1737003

Figure Lengend Snippet: Functional enrichment analysis of Cthrc1 -correlated genes. (A) Top 20 Gene Ontology biological processes (GO-BPs) significantly enriched by Cthrc1 -correlated genes. (B) Top 2000 Cthrc1 -correlated genes were analyzed using the Metascape tool ( https://metascape.org/ ) to explore the relationships between the GO-BP terms. The nodes represent enriched GO-BP terms and are colored by their respective cluster IDs, whereas the edges link similar terms. The most significant term of the cluster is displayed as a label to represent that cluster. The Metascape tool employs a heuristic algorithm to select the most informative terms from the GO clusters. It samples 20 top-score clusters, selects up to the 10 best-scoring terms (lowest p -values) within each cluster, then connects all term pairs with Kappa similarity above 0.3. (C) Top 20 mammalian phenotype ontologies and (D) Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathways significantly enriched by the Cthrc1 -correlated genes.

Article Snippet: CTHRC1 CRISPR RNA (crRNA) (AUGGCAUUCCGGGU ACACCUGUUUUAGAGCUAUGCU) was synthesized by Azenta. crRNA annealed with tracrRNA (IDT), then incubated with Alt-R ® S.p.

Techniques: Functional Assay

Journal: Frontiers in Aging Neuroscience

Article Title: Identification of CTHRC1 as a novel candidate for neurodevelopmental disorders

doi: 10.3389/fnagi.2026.1737003

Figure Lengend Snippet: Correlation of learning and memory phenotypes with Cthrc1 -direct interactors. The hippocampal expression values for the genes interacting directly with Cthrc1 ( n = 17) and phenotype trait data ( n = 341) were obtained from the GeneNetwork portal. The gene-trait analysis was performed using the corrplot R package. Number of (A) all learning and memory phenotypes and (B) significant phenotypes divided into major subgroups. Arm visit: 8-arm radial maze test; CPP: Conditioned place preference; CFC: Contextual fear conditioning; Y-maze: performance on the Y-maze; WMZ: Morris water maze test. The number next to the phenotype group name indicates the number of traits in that group. (C) Barplot showing the number of learning and memory phenotypes correlated with each of the 17 genes. (D) Correlation plot showing the significance between BXD hippocampal mRNA expression of the 17 genes and Y-maze phenotypes. The R values significant with p < 0.05 are marked with an asterisk. Blue squares indicate positive correlation, whereas red squares indicate negative correlation. The size and color intensity of the squares are proportional to the correlation coefficient ( R ) values.

Article Snippet: CTHRC1 CRISPR RNA (crRNA) (AUGGCAUUCCGGGU ACACCUGUUUUAGAGCUAUGCU) was synthesized by Azenta. crRNA annealed with tracrRNA (IDT), then incubated with Alt-R ® S.p.

Techniques: Expressing, Conditioned Place Preference

Journal: Frontiers in Aging Neuroscience

Article Title: Identification of CTHRC1 as a novel candidate for neurodevelopmental disorders

doi: 10.3389/fnagi.2026.1737003

Figure Lengend Snippet: Gene expression changes following CTHRC1 manipulation in SH-SY5Y human neuroblastoma cells. Relative gene expression changes following CTHRC1 (A) siRNA knockdown or (B) overexpression compared to control. Data are presented as mean ± SEM. Statistical significance was determined by t -test (* p < 0.05, ** p < 0.01, *** p < 0.001; ns, not significant). Green bars represent control, whereas orange bars represent CTHRC1 knockdown or overexpression. (C) Western blotting analysis following CTHRC1 overexpression in SH-SY5Y cells. β -actin was used as a control. EV: empty vector.

Article Snippet: CTHRC1 CRISPR RNA (crRNA) (AUGGCAUUCCGGGU ACACCUGUUUUAGAGCUAUGCU) was synthesized by Azenta. crRNA annealed with tracrRNA (IDT), then incubated with Alt-R ® S.p.

Techniques: Gene Expression, Knockdown, Over Expression, Control, Western Blot, Plasmid Preparation

Journal: ACS Omega

Article Title: Universal Smartphone-Assisted Colorimetric Quantitative Platform Based on CRISPR Cas12a Detection for Sensitive and Rapid Diagnosis of Multiple Virulence Genes of Hypervirulent Klebsiella pneumoniae

doi: 10.1021/acsomega.5c08903

Figure Lengend Snippet: Schematic diagram of the CRISPR Cas12-based smartphone-assisted colorimetric quantitative platform (Cas12a-SACQP) for bacterial DNA detection. (A) The scheme is used to detect the amount of bacterial DNA utilizing the CRISPR Cas12a trans-cleavage. At the 5′ and 3′ ends, the ssDNA reporter is doubly labeled with FAM and BHQ1, respectively. (B) The principle of “SACQP” is facilitated by capturing images with a smartphone. The data processing is completed through a self-developed mobile phone application named “Colorimetric Quantitative Visualization Inspection Platform (CQVIP)”. From right to left, it displays the application’s “Main Interface,” “Image Recognition,” “Standard Curve,” and “Quantitative Detection Results.” Images are original photographs by the authors and compiled by using Adobe Illustrator 2022.

Article Snippet: Primers, single-stranded DNA (ssDNA) reporter, and CRISPR RNA (crRNA) were synthesized by Sangon Biotech (Shanghai, China) and BGI (Guangzhou, China).

Techniques: CRISPR, Labeling

Journal: ACS Omega

Article Title: Universal Smartphone-Assisted Colorimetric Quantitative Platform Based on CRISPR Cas12a Detection for Sensitive and Rapid Diagnosis of Multiple Virulence Genes of Hypervirulent Klebsiella pneumoniae

doi: 10.1021/acsomega.5c08903

Figure Lengend Snippet: Optimization of the CRISPR/Cas12a-assisted detection for four virulence genes of hvKp as rmpA , iroB , iucA, and peg-344 . (A–D) Real-time fluorescence intensity curves for different crRNAs, respectively. The fluorescence intensity over 30 min is shown. (E–H) End point fluorescence analysis of different crRNAs at 30 min for the crRNAs shown in (A–D), respectively. (I, J) Optimization of Cas12a and crRNA (iroB-3-588) concentrations. The combination of 30 nM Cas12a and 35 nM crRNA was selected for subsequent assays based on its high signal-to-noise ratio (S/N = 10.52). (K, L) Comparing the fluorescence intensity in (K) real-time fluorescence intensity for 0–30 min and (L) fluorescence intensity at 30 min time points with and without RNase inhibitor. When RNase inhibitor was used, the fluorescence intensity increased by 27.73%. Data are represented as mean ± SD of technical replicates ( n = 3).

Article Snippet: Primers, single-stranded DNA (ssDNA) reporter, and CRISPR RNA (crRNA) were synthesized by Sangon Biotech (Shanghai, China) and BGI (Guangzhou, China).

Techniques: CRISPR, Fluorescence

Journal: ACS Omega

Article Title: Universal Smartphone-Assisted Colorimetric Quantitative Platform Based on CRISPR Cas12a Detection for Sensitive and Rapid Diagnosis of Multiple Virulence Genes of Hypervirulent Klebsiella pneumoniae

doi: 10.1021/acsomega.5c08903

Figure Lengend Snippet: Sensitivity and specificity of the CRISPR/Cas12a-assisted detection for multiple virulence genes of hvKp. (A–D) Linear correlation between fluorescence intensities and the concentrations (conc.) of different target DNAs (E). The heat map displays the results of the specificity of different target DNAs, and it displays the normalized fluorescence intensities as the signal values. (F) Evaluation of each target gene’s ability to inhibit interference. The controls are blank reactions containing the respective gene-specific crRNAs but no target DNA. The mixture was an equal concentration (0.75 nM) of each gene ( rmpA , iroB , iucA , and peg-344 ). Data are presented as mean ± standard deviation (SD) based on technical replicates ( n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

Article Snippet: Primers, single-stranded DNA (ssDNA) reporter, and CRISPR RNA (crRNA) were synthesized by Sangon Biotech (Shanghai, China) and BGI (Guangzhou, China).

Techniques: CRISPR, Fluorescence, Concentration Assay, Standard Deviation

Journal: ACS Omega

Article Title: Universal Smartphone-Assisted Colorimetric Quantitative Platform Based on CRISPR Cas12a Detection for Sensitive and Rapid Diagnosis of Multiple Virulence Genes of Hypervirulent Klebsiella pneumoniae

doi: 10.1021/acsomega.5c08903

Figure Lengend Snippet: Performance in detecting clinical samples of CRISPR/Cas12a-assisted detection for multiple virulence genes of hvKp. (A) The heat map shows the sensitivity in detecting the virulence genes of hvKp, and it displays the normalized fluorescence intensities as the signal values (B, C). Determination of the LOD in detecting clinical samples ( n = 3). (D–G) Specificity analysis of the “Cas12a-SACQP” assay for different bacteria. Insets show representative fluorescence graphs. The y -axis of the bar charts indicates the detected hvKp concentration; dashed lines indicate the LOD for each gene. All strains were used at 0.5 × 10 5 CFU/mL. From left to right, the x -axis labels are: negative control, hypervirulent Klebsiella pneumoniae 69670, Escherichia coli FC-A9-X34-1-H, Staphylococcus aureus 25913, Pseudomonas aeruginosa 27853, Acinetobacter baumannii 84963, Enterococcus faecalis C-M21-X12-3A, and Salmonella typhimurium 14028.

Article Snippet: Primers, single-stranded DNA (ssDNA) reporter, and CRISPR RNA (crRNA) were synthesized by Sangon Biotech (Shanghai, China) and BGI (Guangzhou, China).

Techniques: CRISPR, Fluorescence, Bacteria, Concentration Assay, Negative Control